3) 223(64.8) 245(65.9) 0.90 ≥55 140(35.7) 121(35.2) 127(34.1)   Gender Male 345(88.0) 267(77.6) 306(82.3) 0.001 Female 47(12.0) 77(22.4) 66(17.7)   Alcohol abuse Absent 75(19.1) 44(12.8) 31(8.3) <0.001 Present 317(80.9) 300(87.2) 341(91.7)   Cirrhosis Absent 50(12.8) 331(96.2) 372   Present 342(87.2) 13(3.8) 0   Anti-HCV positive   0 0 0   HBsAg positive   364(92.9) 344(100.0) 0   AFP(ng/ml)   923.3 ± 597.1 7.6 ± 6.9   <0.001 ALT(IU/L)   51.0 ± 24.0 54.0 ± 41.0 21.0 ± 8.1 0.30 AST(IU/L)   36.3 ± 29.4 45.3 ± 34.3 26.1 ± 6.9 0.67 GGT(IU/L) selleck compound   27.7 ± 23.5 39.4 ± 35.7 19.5 ± 17.1 0.56 TBIL(μmol/L)   16.4 ± 12.6 19.0 ± 7.3 12.1 ± 4.2 0.56 Alanine

aminotransferase (ALT), aspartate aminotransferase (AST), γ-glutamyl transpeptidase (GGT) and total bilirubin (TBIL), Alpha Fetoprotein (AFP). FOXP3 SNP genotyping FOXP3 gene SNP genotype data were retrieved from the HapMap Phase II + Phase III database, and the haplotypes were analyzed with restrictive standards (r2 > 0.8 and a minimum allele frequency (MAF) > 0.1) in Haploview 4.2 software. Finally, two tagSNPs, rs2280883 and rs3761549, which were able to cover 80% of the MAF > 0.1 SNPs, https://www.selleckchem.com/products/PF-2341066.html were selected for genotyping.

DNA was extracted from the peripheral blood samples from each patient using standard methods. Genotyping was performed by MALDI-TOF Mass Spectrometry for all donors. The DNA from the donors was blinded, coded and tested using a 384-well format SpectroCHIP microarray. PCR primers and single base extension primers for rs2280883 and rs3761549 were designed using Sequenom Assay design 3.1 software. These primer sequences are shown in Table 2. A MALDI-TOF Mass Spectrometer was used for data acquisition from the SpectroCHIP. The results were analyzed using Sequenom MassARRAY RT software. Table 2 Sequences of PCR primers and single-base extension primers SNPs PCR primers sequences Single base extension primers sequences rs2280883 F: ACGTTGGATGAGATGAAGGAGTTGGGATGG GACAAGGAAAGGTTGGGAA

  R: ACGTTGGATGTGTCAATACACCCCCAACTG rs3761549 F: ACGTTGGATGACCCCACAGGTTTCGTTCC AGTTTCGTTCCGAGAACT   R: ACGTTGGATGACATCACCTACCACATCCAC “F”: Forward, “R”: Reverse. Statistical analysis ALT, AST, GGT, TBIL Resveratrol and AFP levels were reported as the mean ± standard deviation, and the selleck products distributions of these variables were compared by Kruskal-Wallis tests; AFP values between HCC and CHB donors were compared by the Mann–Whitney U test. Patients’ age, gender, alcohol abuse and genotype frequencies were obtained by direct counting and statistical analysis was performed by the chi-squared test. Odds of allele and genotype with 95% confidence intervals (95% CI) in patients with HCC versus CHB or healthy donors were also calculated. P-values less than 0.05 were considered statistically significant. SPSS 13.0 for Windows was used for all statistical calculations.