5 as indicated. Briefly, RNA was extracted from 200 μL of virus supernatant using an RNeasy kit (Qiagen) according to the manufacturer’s protocol. Viral

RNA was then eluted in 50 μL of RNase-free water. A total of 10 μL of viral RNA was then reverse-transcribed to complementary DNA using the Promega Reverse Transcription System (Cat. #A3500) in a 20-μL final reaction volume. A total of 5 μL of viral DNA was then used for real-time polymerase chain reaction along with 5 μL of plasmid standard (pFL-J6/JFH1 plasmid) to contain 10; 100; 1000, 10,000; 100,000; selleck chemical 1,000,000; and 10,000,000 copies per 5 μL. This standard allowed for the quantification of the amount of viruses in our supernatant. Real-time quantitative reverse-transcription polymerase chain reaction (qRT-PCR) was performed with the CFX96 Real-Time System (Bio-Rad Laboratories, Hercules, CA) and SYBR Green PCR Master Mix (Eurogentec, Fremont, CA) using 18S for normalization of the relative gene expression.

Data were analyzed using the comparative ΔΔCt method. Primers for detection of HCV RNA were described.29 Specific primers used included the following: DDX3X, gtggaacaaacactcgctt (sense), high throughput screening compounds acctttagtagct tctcggtt (anti-sense); DDX6, caggaacatcgaaatcgtg (sense), tccaatacgatggagatagg (anti-sense); EIF2C2, cgg acaatcagacctcaacca (sense), cccagtcacgtctgtcatctc (anti-sense); HSP90, acaaggatctgcagccatt (sense), gtcaagctttc ataccggatt (anti-sense); PATL1, tcctgctccctatggtgagag (sense), catggcagcaagtggactacc (anti-sense); and GW182, ctgaacctccctcacggaa (sense), ggctttgtgcaaagaaa cgac (anti-sense). Anti-NS5A (9E10,

kindly provided by Dr. Charles Rice), anti-NS3 (ViroStat, Portland, ME) or anti-CORE (ViroStat), anti-HSP90 (Cell Signaling, Cat. #4874), GW182 antibody (Aviva Systems Biology, Cat. #ARP40956_P050), anti-HA tag antibody (Abcam, Cambridge, MA, Cat. #ab18181), and anti–β-actin (Abcam) were used as primary antibodies, followed by a horseradish peroxidase–labeled secondary antibody (Santa Cruz Biotechnology). For immunoprecipitation MG-132 research buy after specific treatment as indicated, cells where washed twice with ice-cold phosphate-buffered saline (Gibco, Cat. #14190) lysed with immunoprecipitation lysis buffer (Thermo Scientific, Cat. #87788) supplemented with protease inhibitor cocktail (Roche, Cat. #11836153001). A total of 2 μg of each specific immunoprecipitation antibody was then added to each specific sample and a control sample was immunoprecipitated with 2 μg of immunoglobulin G (IgG) control antibody from Santa Cruz Biotechnology (Mouse IgG, Cat. #SC2025 or Rabbit IgG, Cat. #2027) to match the animal species in which the antibody of interest was generated from. After immunoprecipitation samples were subjected to western blot analysis with specific antibodies of interest as indicated. Intracellular staining was performed as described.