However, conspicuous

variations in sensitivity and specificity of invA-based PCR assays have been documented by numerous studies [1, 29–35], and one of the possible reasons for such discordant outcomes may be due to the use of different primers for gene detection in the assays such as Selleck STA-9090 Conventional or qPCR [36]. In an effort to better understand the variations caused by the usage of different primers for gene detection in PCR assays, we systematically evaluated KU-57788 purchase the most commonly used invA primer pairs for the detection of Salmonella in thirteen (n = 13) PCR assays (Table 3; Figure 4). First, although the invA-based PCR assays generate reasonably good results for Salmonella detection, in some cases, the false-negative and false-positive rates were rather high [29]. The reasons

for these false-negative and false-positive results are not clear, but primers and probes used for gene detection may be to blame. Although the invA gene is encoded by almost all strains in Salmonella spp. examined, our BLAST sequence analysis revealed that the invA gene sequence is rather heterogenic among the Salmonella group of more than 2600 serotypes, especially at the 5-′ and 3′- ends of the gene. Furthermore, regions further into the gene, single nucleotide polymorphisms (SNPs) occur sporadically at different locations with variable frequencies p38 MAPK assay among Salmonella spp. Inevitably, it becomes a formidable task to detect such a broad and diversified Salmonella group by targeting a single gene. If previously designed primer pairs listed in Table 3 are used, several PCR assays would fail to detect

numerous Salmonella spp., whose sequences are currently available in GenBank. This could partially explain the false-negative results encountered in Salmonella detection [36]. At the same time, although invA is capable of excluding non-Salmonella strains, our BLAST sequence analysis of invA demonstrated that some non-Salmonella groups such as E. coli, Staphylococcus aureus subsp. aureus, and Solanum lycopersicoides shared identities with Salmonella invA. This could give a possible explanation for the false-positive results reported by some analysis [36]. Table 3 PCR primer pairs used for targeting invA gene for detection of Salmonella Primer sequence (5′—3′) Type of PCR Position Length (bp) O-methylated flavonoid Reference (year) GCTGCGCGCGAACGGCGAAG Conventional 586-608 389 Ferretti et al. (2001) TCCCGGCAGAGTTCCCAT T   972-954     ACAGTGCTCGTTTACGACCT AAT Conventional 104-127 244 Chiu and Ou (1996) AGACGACTGGTACTGATCGATAAT   347-324     GTGAAATAATCGCCACGTTCGGGCAA Conventional 371-396 285 Malorny and Hoorfar (2005) TCATCGCACCGTCAAAGGAACC   655-634     GTGAAATAATCGCCACGTTCGGGCAA Conventional 371-396 285 Rahn et al. (1992) [28] TCATCGCACCGTCAAAGGAACC6   655-634     AGTGCTCGTTTACGACCTGAA Conventional 106-126 229 Mainar-Jaime et. al. ( 2013) [29] TGATCGATAATGCCAGACGA   334-315     ACAGTGCTCGTTTACGACC Conventional 104-122 1614 Banihashemi et al.