Membranes were then washed with TTBS four times for 5 min each, incubated with 12000 dilution of anti rabbit or anti mouse horseradish peroxidase antibody for 1 h at room temperature. Immunoreactive bands were detected using ECL reagents. Co immunoprecipitation assay Cell selleck chemicals lysates containing 1 mg of proteins were incubated with 2 ug of anti c Src antibody at 4 C for 1 h, and then 10 ul of 50% protein A agarose beads was added and mixed at 4 C for 16 h. The immunoprecipitates were collected and washed thrice with lysis buffer without Triton X 100. 5 Laemmli buffer was added, and then subjected to electrophoresis on 10% SDS PAGE. Wes tern blot analysis was performed using an antibody against either anti c Src or anti phospho PDGFR antibody.

Rat MMP 9 promoter cloning, transient transfection, and promoter activity assay The upstream region of the rat MMP 9 promoter was cloned to the pGL3 basic vector contain ing the luciferase reporter system. Briefly, a 1. 3 kb segment at the 5 flanking region of the rat MMP Inhibitors,Modulators,Libraries 9 gene was amplified by PCR using specific primers for the rat MMP 9 gene. The pGL3 Basic vec tor, containing a Inhibitors,Modulators,Libraries polyadenylation signal upstream from the luciferase gene, was used to construct the expression vectors by subcloning PCR amplified DNA of the MMP 9 promoter into the Kpn1Xho1 site of this vector. The PCR products were confirmed by their size, as determined by electrophoresis and by DNA sequencing. Additionally, the introduction of a mis matched primer mutation into the AP 1 to generate pGL3 MMP 9 distal AP 1wtEts was performed, using the following primer distal AP 1wtEts 5 GCAGGAGAGGAAGCTGAGTTGAAGACA 3.

All plasmids were prepared by using QIAGEN plasmid DNA preparation kits. The MMP 9 promoter reporter construct was transfected into RBA 1 cells using Inhibitors,Modulators,Libraries the Lipofectamine reagent according to the instructions of the manufacturer. To assess promoter activity, cells were collected and disrupted by sonication in lysis buf fer. After centrifugation, aliquots of the supernatants Inhibitors,Modulators,Libraries were tested for luciferase activity using the luciferase assay system. Firefly lucifer ase activities were standardized to those of b galactosi dase activity. Chromatin immunoprecipitation assay To detect the in vivo association of nuclear proteins with rat MMP 9 promoter, chromatin immunoprecipi tation analysis was conducted as previously described.

Briefly, RBA 1 cells were cross linked with 1% formaldehyde Inhibitors,Modulators,Libraries for 10 min at 37 C and washed thrice with ice cold PBS containing 1 mM phenyl methylsulfonyl fluoride and 1% aprotinin. Soluble chromatin was prepared using a ChIP selleck chem inhibitor assay kit according to the manufacturers recommen dations and immunoprecipitated without or with anti c Fos or anti c Jun antibody and normal goat immunoglobulin G. Following washes and elu tion, precipitates were heated overnight at 65 C to reverse cross linking of DNA and protein.