As a result, participants in our sample who met our ‘a’, ‘b’ and ‘c’ criteria above, but who reported abstinence from alcohol between Waves 1 and 2, were not asked about their use of alcohol treatment during this interval of time. This applies to 3.34% of our sample (or 75 of the 2245 who met criteria a, b and

c above). Thus, the findings reported within this paper are best interpreted as applying to those Crizotinib price who, in addition to the three criteria above, had persisted in alcohol use after Wave 1. “
“The retinotectal/collicular projection describes the axonal connection between the retina and the tectum (fish/frog/chick), or its mammalian homolog, the superior colliculus (SC), and represents a key model system for studying the development Neratinib of topographic maps. Here neighborhood relationships are preserved such that cells neighboring in one field are connected to cells neighboring in another field, facilitating a faithful transfer of positionally organized information from one area to another. In the retinotectal/collicular projection, the temporal retina is connected to

the rostral tectum/SC and the nasal retina to the caudal tectum/SC, while the dorsal and ventral retina are connected to the lateral and medial tectum/SC, respectively. Members of the EphA/ephrinA family, which were cloned in the 1990s (Cheng et al., 1995 and Drescher et al., 1995), turned out to be prominently Lenvatinib involved in controlling the development of this projection (Feldheim and O’Leary, 2010, Huberman et al., 2008 and Triplett and Feldheim, 2012). Strikingly, the expression patterns of several EphA and ephrinA family members combine

to give rise to counter gradients in both the retina and the SC (Figure 1). Fitting well with the chemoaffinity hypothesis formulated by Sperry (1963), temporal retinal ganglion cell (RGC) axons with high EphA receptor expression map to the rostral SC, which expresses low amounts of ephrinAs, while nasal RGC axons with low EphA receptor expression project to the caudal SC with high ephrinA expression. According to the prevailing concept, temporal axons develop termination zones (TZs) in the rostral SC since their formation in the caudal SC is suppressed by high concentrations of repellent ephrinA ligands. In a knockout (KO) of the three ephrinAs, which are expressed in the retinocollicular projection (ephrinA2, ephrinA3, and ephrinA5), temporal axons form ectopic TZs (eTZs) more caudally. However, the phenotypes are less prominent or completely absent when only a subset of these three ephrinAs are deleted (Pfeiffenberger et al., 2006) indicating a correlation between the expression levels of ephrinAs and the severity of the targeting defects. The mechanisms underlying the mapping of nasal axons to the caudal SC remain poorly understood.

Computer-controlled presentations of Gabor stimuli were then used to measure tuning for direction (eight directions) and temporal frequency (five frequencies) while the animal performed a fixation task. The direction that produced the strongest response was used as the preferred direction, the opposite Trichostatin A direction was used as the null direction, and a direction 90° from the preferred direction was used as the intermediate direction. The temporal frequency that produced the strongest response was used for all of the Gabors. The temporal frequency was rounded to a value that produced an integral number of cycles of drift

Selleckchem PI3K inhibitor during each stimulus presentation, so that the Gabors started and ended with odd spatial symmetry, such that the spatiotemporal integral of the luminance of each stimulus was the same as the background. Spatial frequency was set to 1 cycle per degree for all of the Gabors. The preferred Gabor was used to quantitatively map the receptive field location (three eccentricities and five polar angles)

while the animal performed a fixation task. The two stimulus locations within the receptive field were chosen to be at equal eccentricities from the fixation point and to give approximately equal responses, and the third location was 180° from the center point between the two receptive field locations, at an equal eccentricity from the fixation point as the other locations. Neurons were included in the analysis if they were held for at least two blocks each of both the normalization

and attention data Batroxobin collection, presented in alternating blocks. Approximately 13 repetitions of each stimulus condition were collected per block. Data analysis was performed on the response period of 50–250 ms after the stimulus onset. Firing rates for each stimulus condition of each neuron were determined by taking the average firing rate during this analysis period across all stimulus repetitions. Stimuli presented at the same time as a target or distractor stimulus were excluded from analysis, as were stimuli that appeared after the target, and the first one or two stimulus presentations (within 400 ms) of each stimulus series to reduce variance that could arise from stronger responses to the start of a stimulus series. Modulation indices for the modulations of firing rates reported in this study were calculated using a normalization modulation index, [(Preferred – Null) – (Both - Null)] / [(Preferred – Null) + (Both – Null)], or an attention modulation index, (Attend Preferred – Attend Null) / (Attend Preferred + Attend Null).

e., n = 549 for those who did not miss the dependent variable), thereby avoiding biased standard errors. 32 There were 346 (63.02%)

participants who met the PA recommendation (i.e., 150 min of the PA per week), and those who met the PA recommendation reported more weekly exercise on the LTEQ than those who did not (mean = 61.47, SD = 78.28 vs. mean = 34.61, SD = 56.74, Protease Inhibitor Library clinical trial respectively; t (549) = 4.52, p < 0.001, Cohen's d = 1.50). In spite of the caveats noted above about the LTEQ in this sample, the magnitude of this finding offers concurrent validity related evidence in support of the binary approach employed in this study (i.e., MPAR vs. does not MPAR). We also explored the bivariate correlation among the able, worth, enabling, and reinforcing factors. The results indicated that for able, the correlation between self-efficacy and perceived competence was 0.38. For worth, the correlation between enjoyment and

attitude was 0.59. For enabling factors, the correlations among accessibility, knowledge, language barrier, and skill and fitness were between −0.14 and 0.72. For the reinforcing factors, the correlation between role modeling and peer support was 0.36 (Table 3). The moderate-to-high internal consistency of each scale and low-to-moderate correlations among different scales supports the convergent and discriminant validities of the scales employed. We attempted to identify the factors that best predicted the odds of MPAR among Chinese international students. Tables 4 and 5 show the odds ratio of the logistic nested regression comparing the five nested models. The model Ruxolitinib clinical trial comparison results indicate that adding able factors (Model 2) significantly increased the odds of MPAR prediction, compared to the base model (Model 1). Adding worth factors (Model 3) significantly increased the prediction of the odds, compared to Model 2. Adding enabling (Model 4) and reinforcing factors (Model 5) did not significantly increase the model prediction, compared to Model 3. Therefore,

Model 3 was the final model for MPAR. In Model 3, sex significantly influenced the odds of MPAR. The odds of males meeting the PA recommendation was 1.49 times greater than the odds of females Org 27569 meeting them (p < 0.001). Being one SD higher on BMI increased the odds of MPAR by 1.25 times (p < 0.05). Being one standard deviation higher on competence and efficacy increased the odds of MPAR by 1.95 and 1.68 times, respectively (both p < 0.001). Although the direct effects of the enabling and reinforcing factors on PA lacked statistical significance, the indirect effects of the enabling and reinforcing factors on MPAR through able and worth may still exist. We used the user written command “binary_mediation” in STATA to examine each mediation effect. The results showed that there were no direct effects of the enabling and reinforcing factors on MPAR (all p > 0.

The only significant latent variable to emerge corresponded to a contrast of pHPC and aHPC bilaterally, with this divergence especially apparent in the right hemisphere (n = 13; singular value = 8.9, p < 0.05) (Figure 3A). A nonrotated version of this analysis confirmed that a contrast of pHPC and aHPC connectivity was significant at the whole-brain level. The underlying spatial pattern involved preferential correlation between ON-01910 supplier pHPC and bilateral dorsolateral prefrontal cortex, left anterior cingulate cortex, bilateral posterior

cingulate cortex and retrosplenial cortex, left precuneus, bilateral thalamus (including anterior and dorsomedial nuclei), bilateral inferior parietal lobe,

and bilateral occipital gyrus regions (Figures 3B–3E; Table S3). aHPC correlated preferentially with the lateral temporal cortex in both hemispheres, extending to the temporal poles bilaterally (Figures 3B–3E). Similar findings have been reported elsewhere (Kahn et al., 2008), but selleck compound the current results extend prior evidence by formally demonstrating the stability of the overall pattern. Interestingly, the above pHPC- and aHPC-correlated regions are, respectively, the cortical connections of the polysynaptic intrahippocampal pathway (which connects with frontal and parietal cortices via the fornix) and the direct intrahippocampal pathway (which projects to the anterior temporal lobe via the uncinate fasciculus; Duvernoy, 2005; Figure 3F). Connections of the polysynaptic pathway are believed to support

RM by mediating perceptual (precuneus), attentional (inferior parietal), and strategic (lateral frontal) contributions to it (Spaniol et al., 2009). Integrity of the fornix, which connects the polysynaptic pathway to cortex, is also important for RM (Tsivilis et al., 2008 and Gilboa et al., 2006). In contrast, anterior temporal connections of the direct pathway are associated with the processing of semantic information and social and emotional cues (Rogers et al., 2006 and Olson Pentifylline et al., 2007). Because pHPC linked preferentially with polysynaptic pathway connections, a neural context interpretation is consistent with our finding that larger pHPC volume ratios predict better RM. Hippocampal covariance effects during postencoding rest that are linked to memory success have been interpreted as evidence of hippocampal consolidation (Tambini et al., 2010 and Ben-Yakov and Dudai, 2011). Along these lines, and because pHPC is linked preferentially to regions associated with RM, we explored whether greater pHPC covariance with its functionally connected network during postencoding rest could explain the relationship between pHPC volume ratios and RM.

, 2007). During intertemporal choice, a number of brain areas thought to be important for attention and episodic memory, such as the precuneus and anterior cingulate cortex, show reduced activation in methamphetamine-dependent individuals,

suggesting that the impaired functions of these brain areas might contribute to Selleckchem GSI-IX more impulsive choices (Hoffman et al., 2008). Although dopamine-related drugs have been shown to influence the steepness of temporal discounting, the results from these behavioral pharmacological studies have not been consistent (Peters and Büchel, 2011). As a result, the precise nature of the neural mechanisms linking the use of addictive drugs and temporal discounting needs to be examined more carefully. In patients with Parkinson’s disease, midbrain dopamine neurons are lost progressively. Since these neurons are a major source of inputs Protein Tyrosine Kinase inhibitor to the basal ganglia, motor deficits found in Parkinson’s patients, such as bradykinesia, rigidity, and tremor, are thought to result from the disruption in the disinhibitory functions of the basal ganglia (DeLong, 1990). In addition, considering the extent to which dopamine neurons contribute to the broad propagation of reward prediction signals in the brain, abilities to improve decision-making strategies through experience might be impaired in patients with Parkinson’s disease.

In fact, given the option of learning from positive or negative outcomes of previous choices, Parkinson’s patients tend to learn more from negative outcomes, and this tendency was ameliorated by medication that increase dopamine levels (Frank et al., 2004). Similarly, striatal activity correlated with reward prediction errors was reduced in Parkinson’s patients (Schonberg et al., 2010). Medication that increases dopamine levels in Parkinson’s patients is not likely to restore the normal pattern of dopamine signals completely and therefore may cause a side-effect in choice behaviors of treated

patients. For example, Parkinson’s patients often get addicted to the drugs used in dopamine replacement therapy (Lawrence et al., 2003). Similar to the mechanisms of other addictive drugs (Redish, 2004), this might Tobramycin result from the amplification of reward prediction error signals, since patients treated with dopaminergic drugs showed higher learning rates during a dynamic foraging task (Rutledge et al., 2009). Patients on dopamine replacement therapy also tend to develop problems with behavioral addictions, such as pathological gambling (Driver-Dunckley et al., 2003; Dodd et al., 2005). Previous studies have also found that compared to normal controls, Parkinson’s patients tend to show steeper temporal discounting during intertemporal choice (Housden et al., 2010; Milenkova et al., 2011). As is the case for the relationship between addiction and temporal discounting, whether and how steeper temporal discounting in Parkinson’s disease is mediated by dopaminergic signaling requires further study (Dagher and Robbins, 2009).

Walnuts leaving the rock tank are often rinsed with potable water or sometimes with water containing an antimicrobial such as peroxiacetic acid. Even so,

aerobic plate counts and coliform check details counts of more than 6 and 5 log CFU/nut, respectively, before dehydration are not uncommon ( Blessington, 2011; Frelka and Harris, unpublished). Inoculating product with pathogens at high levels allows for easier enumeration of microbial populations. This may be an appropriate approach if the rates of decline of the pathogen are similar across a wide range of inoculum levels, however, the survival dynamics of various inoculation concentrations may be incongruent. Inshell walnuts were inoculated at 10, 8, and 6 log CFU/nut and stored for 90 days at ambient conditions. Inoculation level influenced the survival of Salmonella on inshell walnuts during both drying of the inoculum and subsequent storage. During the initial 24-h drying period, a greater reduction in Salmonella populations was observed for walnuts inoculated at 6 and 8 log CFU/nut (2.0- and 1.5-log CFU/nut reductions, respectively) than for walnuts inoculated at 10 log CFU/nut (0.7-log CFU/nut reduction) ( Table 1). Inoculum level similarly impacted survival of Salmonella on walnut kernels ( Blessington et al., 2012) and almond Bortezomib manufacturer kernels and inshell pistachios (

Kimber et al., 2012) during postinoculation drying but not during long-term storage of walnut and almond kernels ( Blessington et al., 2012 and Uesugi et al., 2006) or of inshell pecans ( Beuchat and Mann, 2010a). During the first 4 weeks of ambient storage after drying, bacterial populations declined more rapidly for inshell walnuts inoculated at 6 or 8 log CFU/nut than for walnuts inoculated at 10 log CFU/nut (Fig. 1B). Similarly for medium pecan pieces, the decline of Salmonella was greater Diminazene within the first few weeks of storage when inoculated at moderate (5 log CFU/g) compared to high (7 log CFU/g) levels ( Beuchat and Mann, 2010a). When walnuts were inoculated

at 6 log CFU/nut, populations of Salmonella fell below the LOD (1 log CFU/nut) in three out of six samples after 4 weeks and in all six samples by 8 weeks of storage. At an initial inoculum of 8 log CFU/nut Salmonella levels were above the LOD through 8 weeks and fell below the LOD in two of six samples at 12 weeks of storage. Inshell walnuts were inoculated at 4 log CFU/nut with five-strain cocktails of Salmonella, E. coli O157:H7, or L. monocytogenes (4 to 5 log CFU/ml); survival was evaluated over 14 weeks (97 days) of ambient storage ( Table 2). During the 24-h drying period, Salmonella, E. coli O157:H7, and L. monocytogenes declined by 2.1, 2.2, and 1.9 log CFU/nut, respectively, as determined on TSA; declines among the genera were not significantly different.

At 1 hr after BFA washout, GABAARγ2-GFP accumulated in the Golgi apparatus in neurons from mice of each genotype (Figures Epigenetics Compound Library high throughput 8A and 8C), suggesting that ER-to-Golgi transport of GABAARs was unaffected. Importantly, less GABAARγ2-GFP clusters tended to be distributed in the dendrites of neurons

from KIF5A-KO mice at 2, 2.5, and 3 hr after the washout, which was possibly because of the impairment of post-Golgi transport of GABAARγ2-GFP (Figures 8A and 8D). Next, we compared surface expression of GABAAR-GFP in dendrites after BFA treatment and washout between Kif5a-KO and WT mouse neurons. We visualized surface-expressed GABAAR-GFP by immunocytochemistry. After washout of BFA, cells were fixed and incubated with an anti-GFP antibody without permeabilization. Because the p53 inhibitor GFP tag of the GABAAR-GFP construct is located at the outer surface after membrane insertion ( Kittler et al., 2000), we could detect the surface receptor using this procedure. As a result, we observed a significant delay in surface expression of GABAAR-GFP in Kif5a-KO neurons ( Figures 8B and 8E). We

tried to further characterize the alteration of GABAAR transport in Kif5a-KO mouse neurons by comparing the glycosylation state of GABAARs between genotypes. GABAARs are known to be heavily glycosylated in neurons, and some mutations of GABAAR subunits have been reported to be involved in the receptor glycosylation state that can affect the intracellular fate of GABAARs ( Lo et al., 2010; Tanaka et al., 2008). We performed a glycosylation assay of conditional Kif5a-KO and control mouse brain lysates using two enzymes; endoglycosidase H (EndoH), which only digests immature high-mannose sugar, and peptide N-glycosidase F (PNGaseF), which removes all N-linked carbohydrates ( Tomita et al., 2003). As a result, digested band patterns of GABAARβ2/3 and GluR2/3 were similar between genotypes ( Figure 8F), indicating that the glycosylation state of these receptors was not significantly Montelukast Sodium different between

genotypes and that the GABAARs were fully glycosylated in conditional Kif5a-KO cells. Considering that de novo synthesized proteins are glycosylated in the ER and Golgi apparatus, this result suggests that KIF5A is involved in the post-Golgi trafficking of GABAARs, but not in pre-Golgi and intra-Golgi pathways of GABAAR transport. We found an abnormal EEG in the hippocampus of KIF5A-deficient mice. The waveforms represented paroxysms, and spikes and waves were considered to be a typical epileptic discharge (Figures 1F–1H). Such abnormal waveforms are caused by impairment of GABAAR-mediated neurotransmission (Jacob et al., 2008). Consistently, we found an impairment of mIPSCs and eIPSCs together with increased neuronal excitability (Figure 2) and reduced cell surface expression of GABAARs in KIF5A-deficient mice (Figure 3). These results emphasize the role of KIF5A protein in GABAAR trafficking.

After

TEV protease cleavage, GV translocates into the nucleus and induces the reporter Gaussia Luciferase gene expression (pNEBr-X1Gluc) (New England BioLabs, IZASA, Barcelona, Spain), which is secreted into the cell culture medium. TEV protease was divided in two fragments: the TEV-N (residues 1–118) and the TEV-C (residues 119–242). We fused the TEV-N fragment, the TEV protease recognition site and the chimeric transcription factor GV to the C-terminal of ClC-2, the mutant ΔNClC-2, or DmClC-2 in a pCDNA3 vector containing a CMV promoter. In addition, we fused the TEV-C fragment to MK-2206 cost the C-terminal of ClC-2, ClC-5, ΔNClC-2, GlialCAM wild-type, HepaCAM2, GlialCAMΔC, NVP-AUY922 manufacturer GlialCAM containing the mutations R92Q, R98C, R92W, and G89D, and the adenosine 2A receptor. The fusion of the TEV-C fragment to 4F2hc was done N-terminal. All the proteins with the TEV-C fragments were cloned in a pCDNA6.2/V5-pL Dest, containing the herpes simplex virus thymidine kinase (HSV-TK) promoter, to provide low to moderate levels of expression. All the expression plasmids were constructed by PCR using a polymerase with proofreading (KOD Hot Start polymerase,

Calbiochem, Darnstadt, Germany), adding the attB1, attB2, attB5R, or attB5 recombination sites compatible with the Multisite Gateway System (Invitrogen, Carlsbad, CA, USA). All protocols were performed according to the manufacturer’s instructions (Invitrogen). HeLa cells were transiently transfected with the corresponding cDNA constructs. The total DNA transfected was 2 μg, with the following ratios: 0.75 μg of each protein containing the TEV-N and the TEV-C fragments, 0.3 μg of the reporter gene pNEBr-X1GLuc, GABA Receptor and 0.2 μg of the pCMV-βGal vector, which was used to monitor the transfection efficiency. After 48 hr, 20 μl were removed from the supernatant of the cells and Gaussia luciferase activity was measured in a TD-20/20 luminometer (Turner BioSystems, Madison, USA), after the addition of 20 μM of native colenterazine. To normalize

the data, cells were solubilized and 30 μl of the cell lysates were used to measure the β-Galactosidase enzyme activity using the Luminiscent β-Galactosidase Detection Kit II (Clontech) in the same luminometer. For determination of the statistical significance between groups, either the Student’s t test or the Bonferroni’s comparison test were used. p values are annotated in each figure. Values depicted are means ± SEM. We thank Pablo Cid for the gift of DmClC-2 and human ClC-2 with an HA extracellular tag, Muriel Auberson for the generation of the ClC-2 C1 antibody and Soledad Alcántara for the NG2 antibody. We thank Alejandro Barrallo and Manuel Palacín for comments on the manuscript. This study was supported in part by SAF 2009-07014 (R.

For the 24 hr Matrigel outgrowth assays, MatTek dishes were coated (24 hr at 37°C) with 10% Matrigel mixed with either human IgG-Fc (Jackson Immunoresearch) or EphA4-Fc

(R&D Systems). To precluster the Fc fusion proteins for some experiments, we combined each Fc protein with mouse-anti-human Fc (Jackson Immunoresearch) for 1 hr at a 1:10 molar ratio. For each experiment, the spiral ganglion was removed at E12.5 and placed onto a precoated dish with normal culture medium and permitted to grow for 24 hr. For neuron and mesenchyme coculture experiments, a spiral ganglion and an equivalent-sized portion Selleck Talazoparib of otic mesenchyme were removed from the cochlea at E12.5 and transferred to Matrigel-coated MatTek dishes (5% for 1 hr at 37°C), containing solutions of either standard control MO or a Pou3f4-specific MO (GATCCTCTACTAGTTATAATGTGGC). Neuron and mesenchyme explants were plated approximately 1 mm from each other before receiving Endo-Porter (0.6% final; Gene Tools) to facilitate delivery of the MOs. After 2 days at 37°C, the MO and Endo-Porter-containing medium was NVP-BGJ398 replaced with normal culture medium and grown an additional 3 days. For some experiments, soluble preclustered

human IgG-Fc or EphA4-Fc was added to cultures following 2 days Morpholino exposure. Both IgG-Fc and EphA4-Fc were used at 10 nM based on a previous report (Brors et al., 2003). For culture experiments comparing Fc versus ephrin-B2-Fc (R&D Systems), we did not perform preclustering. ChIP was performed as described Phosphoribosylglycinamide formyltransferase previously (Jhingory et al., 2010) but with minor modification. E15.5 cochleae were isolated in

chilled PBS and then fixed for 20 min using 4% paraformaldehyde. The Agarose ChIP Kit (Pierce) was used for subsequent DNA digestion and precipitation. Approximately 8 μg of chicken anti-Pou3f4 or chicken IgY (negative control) and PrecipHen beads (Aves Labs) was used for IP. With resulting DNAs, we performed qPCR using SYBR Green. For each primer set, a standard curve was generated using mouse genomic DNA; control and experimental Ct values were compared to this standard curve for quantification. The data here represent at least two independent ChIPs and three qPCR analyses for each primer set. Please see Supplemental Experimental Procedures for lists of the antibodies, in situ hybridization probes, qPCR primers, quantification methods used in the study, and a description of the microarray that identified Epha4. We thank the members of the Kelley laboratory for their valuable discussions and technical assistance during this work. We thank Dr. Lisa Cunningham (NIH/National Institute on Deafness and other Communication Disorders [NIDCD]), Dr. Doris Wu (NIH/NIDCD), and Dr. Maria J. Donoghue (Georgetown University) for the critical reading of this manuscript. Epha4 null tissue was a kind gift from Dr. Maria J. Donoghue. Mr. Jonathan Stuckey was very helpful with the illustration in Figure 8.

, 2004 and Bischof et al., 2007). These libraries are still being constructed ( Dietzl et al., 2007 and Ni et al., 2009). Another advantage of the ΦC31 system is that RNAi parameters can directly be compared to each

other and therefore be optimized ( Ni et al., 2008 and Ni et al., 2009). These studies also illustrated that short hairpin RNAs (shRNA) modeled on an endogenous microRNA are an effective alternative for classical dsRNA mediated RNAi in the generation of genome-wide RNAi libraries ( Ni et al., 2011). shRNA-mediated RNAi can be directed toward Tenofovir price alternative exons and allowed studying the function of alternative splice variants ( Shi et al., 2007 and Yu et al., 2009b). RNAi experiments can result in unwanted phenotypes due to off-target knockdown. RNAi rescue strategies provide a solution to this problem: one exploits genome-wide libraries of a related species, Drosophila pseudoobscura ( Kondo et al., 2009, Ejsmont et al., 2009 and Langer

et al., 2010), since genes and their regulatory regions of Drosophila pseudoobscura are similar enough to rescue genes of Drosophila melanogaster, but divergent enough to resist the RNAi machinery. Another strategy uses GAL4 to express a UAS rescue construct with altered codon usage that resists the RNAi degradation ( Schulz et al., 2009). In summary, advantages of RNAi experiments are that they can be performed in a tissue-specific fashion using the GAL4-UAS system. Disadvantages Selleck Vorinostat are that off-target effects are not uncommon and knockdowns are almost always incomplete. It is difficult to compare the efficiency of different screening strategies. An RNAi screen to identify novel players in the Notch pathway (Mummery-Widmer et al., 2009) did not identify any of the genes that have been isolated using Flp/FRT screens with EMS mutagenesis ( Jafar-Nejad et al.,

2005, Acar et al., 2008 and Tien et al., 2008) with one exception PRKACG ( Rajan et al., 2009). Homologous recombination or gene targeting can be used to generate modifications or mutations in specific genes in their normal chromosomal context. Gene targeting in Drosophila is performed using one of two methods: ends-in gene targeting and ends-out gene targeting ( Wesolowska and Rong, 2010). The result of ends-in gene targeting is a local duplication at the targeting site, due to the integration of the entire targeting vector ( Rong and Golic, 2000 and Rong and Golic, 2001). This duplication can be resolved during a second round of homologous recombination catalyzed by the meganuclease I-CreI ( Rong et al., 2002), resulting in precisely engineered alleles of several genes required in the nervous system that include point mutations, deletions, gene swaps, protein tags, GAL4 insertion, or splice form reduction ( Demir and Dickson, 2005, Stockinger et al., 2005, Brankatschk and Dickson, 2006, Hattori et al., 2007, Hattori et al., 2009 and Spitzweck et al., 2010).