Therefore, the weak ultraviolet emission and dominant blue band in the PL spectrum demonstrate the existence of ZnO and a large number of oxygen vacancies in the as-grown specimen. A comparison

of the hemispherical reflectance of the branched ZnO/Si nanowire find more arrays and a flat silicon wafer is provided in Figure 3d. The reflectance of the arrays is less than 15% over the wavelength range from ultraviolet to the mid-infrared FK506 cost region, which is drastically decreased relative to that of the silicon wafer. This significant property suggests that the nanotrees might be a promising candidate of antireflective surfaces or photoelectronics and photocatalysis for sunlight harvest. The ultralow reflectance of the specimen may result from the enhanced light-trapping and scattering for rough surface and large surface area of the nanotree arrays, multiple scattering of light within the hierarchical structure, as well as an effective FRAX597 refractive index (RI) gradient from air (RI ≈ 1.0) through ZnO nanowire array (RI ≈ 2.0) to Si nanowire array and substrate (RI ≈ 3.5) [18]. In addition, the abrupt drop in reflection is originated from band-edge absorption of the specimen [27]. The direct and

indirect bandgaps of the components can thus be estimated by the onset points, which are 397 nm (equal to 3.123 eV) for the direct bandgap of ZnO nanowire branches and 1,221 nm (equal to 1.015 eV) for the indirect bandgap of Si nanowire backbones. In contrast to the Si wafer value 1,213 nm (equal to 1.022 eV) or to the general value of bulk materials, 3.37 eV

for ZnO [7] and 1.12 eV for Si [5], the bandgaps of the as-grown specimen are found to be faintly narrowed down, suggesting Tyrosine-protein kinase BLK ideal components of the object. The small difference may be due to the presence of ionic vacancies and structural defects in the nanotrees, as testified in the PL spectrum. The above results and analysis confirm that branched ZnO/Si nanowire arrays with hierarchical structure can be facilely grown on the silicon substrate in a wafer scale by the cost-effective methods. However, as the procedure includes chemical etching for the silicon backbones and hydrothermal growth of the ZnO branches, different synthesis parameters may cause serious influences on the structure and performance of the ZnO/Si nanowire arrays. For this reason, we systematically study crucial influences of the key parameters on the structure of the objects. First, the influence of etching solution on the silicon backbones is investigated, and the results are shown in Figure 4. We can see in Figure 4a that the Si nanobelt or nanowire arrays orient vertically on the Si substrate when the substrate was immersed into aqueous solution of HF/AgNO3 (5.25/0.02 M) at room temperature for 20 min.

Indeed, it has been shown that the reduction factor due to the incoherent pair excitations has a simple theoretical expression and that the nodal and

antinodal spectra are peaked at the order parameter and at the pairing energy, Osimertinib cost respectively, taking into account a realistic lifetime effect [24, 25]. Therefore, the latter part of Equation click here 5 is consistent with the strong coupling scenario, and furthermore, the two distinct lines in Figure 2e are naturally interpreted as the energies of the condensation and formation of the electron pairs. Renormalization features in dispersion In the nodal direction where the order parameter disappears, one can investigate the fine renormalization features in dispersion. They reflect the intermediate-state energy in coupling between an electron and other excitations, and thus provide important clues to the pairing interaction. As for the electron-boson coupling, the intermediate state consists of a dressed electronic excitation and an additional bosonic excitation (Figure 3a). Averaging the momentum dependence for simplicity, the energy distribution

of the intermediate state is expressed by A(ω – Ω) Θ(ω – Ω)+A(ω + Ω) Θ(-ω – Ω) for a given boson energy Ω and for zero temperature, owing to the Pauli exclusion principle. Therefore, taking into account the effective energy distribution of the coupled boson, α 2 F(Ω), the self-energy is written down as follows: (6) (7) where 0+ denotes a positive infinitesimal. Figure 3 Simulation for a single coupling mode at Ω = 40 meV. Dotted

see more and solid curves denote those with and without a d-wave gap of Δ = 30 meV, respectively. (a) Diagram of electron-boson interaction. (b) Eliashberg coupling function α 2 F(-ω), dispersion k(ω) = [ω + ReΣ(ω)]/v 0, and momentum width Δk(ω) = -ImΣ(ω)/v 0. (c) Real and imaginary parts of 1 + λ(ω). In ARPES spectra, the real and imaginary parts of self-energy manifest themselves as the shift and width of spectral see more peak, respectively. Specifically, provided that the momentum dependence of Σ k (ω) along the cut is negligible, and introducing bare electron velocity v 0 by , it follows from Equation 2 that the momentum distribution curve for a given quasiparticle energy ω is peaked at k(ω) = [ω-ReΣ(ω)]/v 0 and has a natural half width of Δk(ω) = - ImΣ(ω)/v 0. We argue that the mass enhancement function defined as the energy derivative of the self-energy, λ(ω) ≡ -(d/d ω)Σ(ω), is useful for the analysis of NQP [7, 26]. The real and imaginary parts of λ(ω) are directly obtained from the ARPES data as the inverse of group velocity, v g(ω), and as the differential scattering rate, respectively. (8) (9) We note that -Imλ(ω) represents the energy distribution of the impact of coupling with other excitations and can be taken as a kind of coupling spectrum.

We inserted such a kanamycin marker downstream of araC with the following primers: 5′_araC_yabI_insert AATCAGACAATTGACGGCTTGACGGAGTAGCATAGGGTTTTGTGTAGGCTGGAGCTGCTTC; 3′_araC_yabI_insert GCATAATGTGCCTGTCAAATGGACGAAGCAGGGATTCTGCCATATGAATA

TCCTCCTTAGTTCCTAT. The insertion was done in DY330 following the protocol described by [42], verified by PCR and moved to MG1655 by P1 transduction, Ferrostatin-1 price thus generating TB55. TB55 was subsequently used to generate a PCR product that spanned the kanamycin cassette adjacent to araC, araC, the full intergenic region between araC and araB, and 42 basepairs at the 5′ and 3′ -prime ends that were homologous to the upstream and 5′-coding region of ygjD, dnaT ,fldA or ffh. The sequence of the primers was ygjD_insert5′ AGTTTTACATCAACCCGCATTGGTCCTACACTGCGCGGTAATAATGTGCCTGTCAAATGGACG ygjD_insert3′ GCCGGTTTCATCGCAGGAAGTTTCAATACCCAGTACACGCATCGTTTCACTCCATCCAAAAAA dnaT_insert5′ TCCGTGTGTTACTATAAAAGTTATCTCCCTTCTCGTTCATCGAATGTGCC TGTCAAATGGACG dnaTC_insert3′ GTCAATACCAACGACGTCCGGGGTCAAAACTCTGGAAGACATCGTTTCAC

TCCATCCAAAAAA ffh_insert5′ GACGCCTTCATGTTATACTGCGGCAAAATACTGATGATGTGTAATGTGCC TGTCAAATGGACG ffh_insert3′ GCGCAGCGTGCGCGACAAACGATCGGTTAAATTATCAAACATCGTTTCAC TCCATCCAAAAAA fldA_insert5′ TGCCTTTATCCGTGGGCAATTTTCCACCCCCATTTCAATAAGAATGTGCC TGTCAAATGGACG fldA_insert3′ ATTACCGGTGTCGCTGCCGAAAAAGATGCCAGTGATAGCCATCGTTTCAC TCCATCCAAAAAA DY330 cells were grown in LB medium supplemented with 0.2% Blasticidin S datasheet L-arabinose and made electro- and recombination competent [42], and electroporated with the above described PCR product. After electroporation,

cells Tozasertib concentration were transferred to LB medium containing 0.1% L-arabinose and incubated at 32° for 1.5 hours prior to plating on LB plates agar containing L-arabinose (0.1%) and kanamycin (50 μg/ml, Sigma). Clones were checked on LB agar plates supplemented with 0.4% glucose to confirm that they were unable to grow in the presence of glucose. The promoter fusions and the adjacent araC gene were verified by sequencing with the following primers: araC_FW GCTACTCCGTCAAGCCGTCA; triclocarban ygjD_RW GGCAATTGGTCTGGGGAGCA. dnaTC_RW AGAGTTGATCGTCCAGAGCG ffh_RW ATTTTGACGAACTCCTGCCC fldA_RW CGAGAGTCGGGAAGAAGTCA The constructs were then moved by P1 transduction into MG1655. To construct TB80 the kanamycin cassette was removed with pCP20. The knockout ΔrelA::kan was derived from the KEIO library clone JW2755 [2] and P1-transduced into TB82. ΔspoT::kan was introduced using AB1058) as donor strain for P1 transduction. To measure activity of the promoters Para, Prsd and Papt, MG1655 and TB80 were transformed [37] with plasmids that contain transcriptional promoter-gfp fusions [29]. Microscopy LB agar pads were prepared by filling a cavity of a sterile microscope cavity slide with a drop of freshly melted LB agar, and covering it with a cover slip to attain a flat surface. The cavity slide was transferred to a fridge for a short time to allow the agar to solidify.

All efforts were made to minimize the suffering of animals. Bacterial strains and phage used S. aureus ATCC 43300(MRSA) and S. aureus ATCC 29213(MSSA) from ATCC, Mannasse, USA were used in this study. These two strains were used to study the bacterial adherence, invasion and cytotoxicity GDC-0449 mw on cultured murine epithelial cells. However, S. aureus 43300 was used to establish

the nasal colonisation in BALB/c mice. Selleckchem PFT�� Clinical isolates of S. aureus were procured from Post-graduate Institute of Medical Education and Research (PGIMER), Chandigarh, India. The strains were isolated from clinical specimens (nasal screening swabs, blood, pus, soft tissue, wound swabs, respiratory samples and body fluids) collected from both in-patient and as out-patient subjects. The strains were identified on the basis of Gram reaction, growth on mannitol salt agar (MSA), catalase activity, Ricolinostat mw and coagulase test. Methicillin resistance was determined using cefoxitin disk on Mueller-Hinton agar (Oxoid) followed by determination of MICs of oxacillin for these strains as recommended by Clinical and Laboratory Standards Institute (CLSI) [15]. A total of thirty four MRSA isolates were selected, numbered sequentially as MRSA 01 to MRSA

34 (clearly depicting their source) and stored in glycerol at −80°C. These strains were used for determining the lytic spectrum/host range of the isolated phage. S. aureus specific

bacteriophage, MR-10, which had been isolated and characterized in our laboratory was used in the present study [13]. This phage was selected as it showed a broad host range against four standard strains of S. aureus [S. aureus ATCC 43300(MRSA), S. aureus ATCC 29213(MSSA), S. aureus ATCC 25923(MSSA) and S. aureus ATCC 33591(MRSA)] as well as was effective against 32/34 clinical MRSA isolates (data depicting the host range of MR-10 is included in Additional file 1: Table S1). Animals used BALB/c female mice, 4–6 weeks old weighing 20–25 g were used in this study. The animals were obtained from Central Animal House, Panjab University, Chandigarh. The animals were kept in well aerated rooms and given antibiotic free diet (Hindustan Lever, Cisplatin Mumbai) and water ad libitum. Isolation and culturing of murine nasal epithelial cells (NEC) This was performed according to the method of Grubb et al. [16]. Nasal septum was dissected from five mice and washed with Dulbecco modified Eagles Medium (DMEM) with 100 μg/ml streptomycin. The septum was homogenized and centrifuged at 2000 rpm for 10 min. The nasal tissue was re-suspended in dissociation medium (10 mM HEPES- streptomycin-DMEM) overnight at 4°C. Next day, the tissue suspension was again centrifuged and suspended in isolation media (145 mM NaCl, 4.

The carbohydrate content in the G drink was 66 g.L-1, which is approximately in-line with the current American College of Sports

CFTRinh-172 Medicine recommendations [4]. These guidelines were based on the understanding that carbohydrates ingested during exercise could only be oxidized at a maximum rate of 1 g.min-1[33]. However, advances in carbohydrate metabolism research have determined up to 1.75 g.min-1 can be oxidized when using multiple transportable carbohydrates, such as glucose and fructose [34]. As such, the carbohydrate content in the INW drink was comprised of glucose and fructose delivered in a 2:1 ratio at 1.3 – 1.5 g.min-1 based on a concentration of 90 g.L-1. Previous work has determined this ratio of carbohydrate delivered in solution and ingestion at 1.5 g.min-1 can improve

exogenous carbohydrate metabolism during exercise by 13% [35] to 48% [36] compared to consuming an isocaloric Selleckchem BEZ235 glucose only solution. While carbohydrate oxidation was not measured in this study, consuming a drink with high carbohydrate concentration using multiple transporters has a potentially Selleck CYT387 powerful effect for sailing athletes, as World Cup regattas last 5–7 days with up to three hours of competitions per day. Therefore, reducing endogenous carbohydrate oxidation could potentially preserve stored muscle glycogen energy for later in the competition, which has previously been found to have a performance enhancing effect [37]. During competition, sailors can spend anywhere from two hours to six hours on-water, with time divided between warm-up, racing and waiting for changes in wind and weather and cool-down. Given the length of time on-water, the co-ingestion of carbohydrates Thiamet G and protein is necessary to prevent extended periods of muscle protein breakdown. Research examining the addition of whey protein to carbohydrate electrolyte beverages has revealed inconsistent results for improved athletic performance in both acute exercise [38, 39] and cycling time trials [40, 41]. In these studies, the addition of protein to an experimental beverage was focused on improving athletic performance

in acute exercise. In contrast, the addition of protein to a carbohydrate electrolyte drink used during multi-day competitions may be more appropriate for metabolic reasons and worthy of continued investigation. Saunders et al. [42] found the use of a fluid replacement drink fortified with protein during a two cycle-to-exhaustion tests within the same day was effective in attenuating the nutritional deficit incurred during exercise and helped to reduce skeletal muscle damage compared to a carbohydrate electrolyte drink alone. Therefore, performing multiple bouts of exercise within a day or consecutive days of competition may be necessary to fully observe the nutritional and physiologic effects of protein ingested with a carbohydrate electrolyte beverage during exercise [43].

Figure 5 Schematic of the nanochannel scratching with V stage and V tip in the opposite direction when V stage   >  V tip . Schematic of the machining state after ( a ) one and ( b ) two AFM scanning cycle. ( c ) Schematic of the cross section of www.selleckchem.com/products/VX-770.html the machined nanochannel. To demonstrate the capability of the AFM-based fabrication method presented

in this study, five channels with different machining parameters corresponding to the conditions mentioned above were created on the aluminum alloy sample. The scan size (L tip), scan rate of the AFM (f), and the number of line-scanning within one scanning process (s) are set to 10 μm, 4 Hz, see more and 300, respectively, for all scratching tests. Thus, the feed velocity of the AFM tip V tip is calculated to be 133.3 nm/s using Equation 1. The machining results are described and analyzed in detail in Section ‘Results and discussion’. Results and discussion Figure 6 shows the AFM and SEM images of the nanochannels scratched with the stage motion and the feed rate in the same direction. As shown in Figure 6a, the nanochannel machined with the stage velocity V stage of 50 nm/s and the normal load of 36.06 μN has two-ladder structure, which agrees well with the condition shown in Figure 2c discussed in the part (1) of Section 3.1 (V stage < 0.5V tip). However, the fluctuation

of the channel bottom is very large. Due to V tip larger than V stage, the displacement of the tip selleck relative to the sample in one scanning process is in the positive direction of x axis shown in Figure 2a. As shown Astemizole in Figure 7a which is the SEM image of the AFM diamond tip, the edge and the face of the tip can be observed clearly. Figure 7b shows the front view of the nanochannel fabrication process, and Figure 7c shows the A-A cross section indicated in Figure 7b, which represents the condition with the displacement of the tip

relative to the sample in one scanning process in the positive direction of x axis. Δ′ and x′ axis, shown in Figure 7c, are defined as the projections of the feed of the tip (Δ) and x axis in the A-A cross section. In addition, α is the attack angle between the tip and the sample surface which can be used to determine the removal mechanisms of the materials. Thus, considering the geometry of the AFM tip shown in Figure 7c, the edge of the AFM tip plays a main role in the scratching test. For increasing α, three removal mechanisms have been proposed: plowing, wedge formation, and cutting [21]. For AFM diamond-tip-based nanomachining, if the attack angle is larger than a certain value (75° in [22]), cutting is the dominant mechanism. Using Equation 11, the real pitch in scratching is calculated to be 10 nm.

0 g of kasugamycin per tree). Five trees were injected with water as injection controls (CK). Injections were made using an Avo-Ject syringe injector (a catheter-tipped 60 ml syringe; Aongatete Coolstores Ltd., NZ) beginning in August of 2010. The tapered tip was firmly fitted into a 19/64-in (7.5 mm) diameter hole, ≈3 cm deep, drilled into the tree. The injector was kept in the tree and the treatment lasted

for one week in each injection-trunk. Treatments were repeated every two months for one year and ceased in August of 2011. Before and during treatment more than 30 leaf samples per tree were taken from Cell Cycle inhibitor different positions around the tree canopies for qPCR assays at two month intervals. Genomic DNA extraction and qPCR analysis for the HLB bacterium Each leaf sample was rinsed three times with sterile water. Midribs were separated from the leaf samples and cut into pieces of 1.0 to 2.0 mm. DNA was extracted from 0.1 g of tissue (fresh weight) of leaf midribs using Qiagen’s DNeasy Plant Mini Kit (Qiagen, Valencia, CA) according to the manufacturer’s protocol. The bacterial titers were quantified by qPCR using the primers and probes S63845 (HLBas, HLBr, and HLBp)

for ‘Ca. L. asiaticus’ as described previously [17, 33]. Data were analyzed by a generalized linear mixed model using the SAS procedure GLIMMIX. Differences among treatments and sampling time points were determined with the LINES option of the LSMEANS statement. PCR amplification of 16S rRNA genes for PhyloChip™ G3 hybridization DNA for the PhyloChip™ G3 analysis, which was extracted from 20 samples of the same treatment, was pooled in equal amounts and quantified by the PicoGreen® method. The PhyloChip™ G3 analysis was conducted by Second Genome Inc. (San

Francisco, CA). The bacterial 16S rRNA genes were amplified from the above pooled DNA using an Chloroambucil eight-temperature gradient PCR (annealing temperatures of 48.0, 48.8, 50.1, 51.9, 54.4, 56.3, 57.5, and 58.0°C) with bacterially directed primers 27 F (5-AGA GTT TGA TCC TGGCTC AG) and 1492R (5-GGT TAC CTT GTT ACG ACT T). In brief, the 25 μl reactions (final concentrations were 1× Ex Taq Buffer with 2 mM MgCl2, 200 nM each primer (27 F and 1492R), 200 μM each dNTP, 25 μg bovine serum albumin (Roche Applied Science, Indianapolis, IN), and 0.625 U Ex Taq (TaKaRa Bio Inc., Shiga, Japan) were amplified using an iCycler (Emricasan chemical structure Bio-Rad, Hercules, CA) under the following thermocycling conditions: 95°C for 3 min for initial denaturation, 35 cycles of 95°C for 30 s, 48 to 58°C for 30 s, and 72°C for 2 min, and then final extension for 10 min at 72°C. PCR products from each annealing temperature for a sample were combined and concentrated using Amicon centrifugal filter units (Millipore Corp., Billerica, MA). The samples were quantified by electrophoresis using an Agilent 2100 Bioanalyzer® before application to the PhyloChip™ G3 array. PhyloChip Control Mix™ was added to each amplified product.

Follow-up investigations will determine the mechanisms

of achieving this steady state or dormancy and mechanisms for overcoming drug resistance in the dormant cells. Additional components will be added to the model, including a third dimension to validate the biological implications of our data prior to in vivo confirmation. In vivo effects of modulating RhoA activation in a murine metastasis model will confirm the functional role of RhoA inactivation in maintaining dormancy in micrometastases. This model is one of several that have begun to generate data and hypotheses regarding this little understood but enormously significant biologic phenomenon. Our model fits with the concept of reversible growth/proliferation buy CB-839 arrest or quiescence governed by a genetic program which ensures the suppression of terminal differentiation [55]. The panel of genes comprising this state is activated regardless of the signal that initiates growth arrest. We have previously demonstrated that FGF-2 initiates reversible growth arrest in MCF-7 and T-47D cells [14] and that this effect is mediated through

TGFβ [56]. TGFβ and the BMP family are inhibitory to breast cancer cells that have not undergone AZD3965 solubility dmso epithelial mesenchymal transition [57] and can suppress micrometastases when administered in vivo [58]. A well-developed model of dormancy demonstrates a role for the urokinase receptor (u-PAR) Guanylate cyclase 2C activation in the exit from dormancy [59]. The model describes the upregulation of integrin α5β1, and the ability of the latter to propagate signals from fibronectin through the EGF-receptor and ERK to cause single quiescent

cells to enter the cell cycle [59]. Similarly, a recent model of breast cancer dormancy demonstrated that the transition from quiescence to proliferation of breast cancer cells was dependent on fibronectin production and signaling through integrin β1, GSK2118436 leading to cytoskeletal reorganization with F-actin stress fiber formation [60]. These models are completely congruent with our hypothesis, despite first impressions. We have previously demonstrated that fibronectin increases the number of dormant MCF-7 and T-47D clones incubated with FGF-2, but nevertheless, the cells remain dormant [3].

The hydrolytic potential of B. firmus and B. indicus genomes correlates with growth on selected carbohydrates The CAZy annotation results were compared

to the growth profile of B. firmus GB1 and B. indicus HU36 (Table 2). Overall the growth profiles of both strains on minimal medium supplemented with selected monosaccharides, disaccharides or cellulose correlated with the presence of related CAZymes in their genome (Additional Files 1 and 2). B. firmus GB1 Torin 1 supplier was able to grow efficiently in minimal medium supplemented with glucose, fructose, arabinose, mannose, xylose, sucrose or trehalose, as selleck compound expected by the presence of candidate specific GHs (Additional File 4). Weak growth was observed with galactose, lactose,

maltose and cellulose, while growth was not supported only by fucose (Table 2 and Additional File 4). B. indicus HU36 was able to grow efficiently in minimal medium supplemented with glucose, fructose, mannose, maltose, sucrose or trehalose, as expected by the presence of candidate specific GHs (Additional File 4). Weak growth was supported by galactose while growth was not observed in the presence of arabinose, fucose, xylose, lactose or cellulose as sole carbon sources in agreement with the absence of candidate specific GHs (Table ACP-196 in vivo 2 and Additional File 4). Table 2 Growth and pigment formation in minimal and rich media   Bacillus firmus GB1 Bacillus

indicus HU36   Minimal medium a Rich medium b Minimal medium a Rich medium b   growth pigment growth pigment growth pigment growth pigment NO SUGAR – - + + – - + + Glucose + – + – + – + – Fructose + – + – + – + – Galactose +/- – + + +/- – + + Arabinose + – + – - – + + Mannose + – + – + – + – Fucose – - + + – - + + Xylose + – + – - – + + Lactose +/- – + +/- – - + + Maltose +/- – + +/- + – + – Sucrose + – + – + – + – Trehalose + – + – + – + – Cellulose +/- DNA Damage inhibitor – + +/- – - + + a M9 minimal medium; bLB rich medium. We never observed carotenoid formation in solid minimal medium supplemented with any of the carbohydrate analyzed (Table 2). When the same selected carbohydrates were used to supplement rich (LB) medium, growth was always allowed but carotenoid formation was inhibited by all sugars able to support efficient growth as sole carbon source (Table 2). Galactose that, as sole carbon source, weakly supported growth of both B. firmus and B. indicus did not affect carotenoid synthesis in either organisms (Table 2), while lactose, maltose and cellulose were also able to support a weak growth of B. firmus and showed a partial negative effect on carotenoid production (Table 2). Results of Table 2 are, therefore, suggestive of a catabolite repression-like control on carotenoid biosynthesis in both pigmented Bacilli.

Figure 1 Standard curve for the indirect competitive ELISA made with purified antigens of B. cinerea covering a range of antigen concentration between 0 and 100 μg mL -1 . Each value is based on five determinations. The error values represent the standard deviation. Sapanisertib manufacturer The coefficient of variation (CV) for

the determination of 25 μg mL-1 B. cinerea was below 4% (six replicates). The www.selleckchem.com/products/PD-173074.html precision of the ELISA assay was checked with control solutions of 5, 25 and 75 μg mL-1 B. cinerea purified antigens concentrations. The within-assay precision was tested with 5 measurements in the same run for each sample. These series of analyses were repeated for three consecutive days in order to estimate the between-assay precision. The results obtained are presented in Table 1. The B. cinerea immunoassay showed good precision; the CV within-assay values were below 4% and the between-assay values were below 7%. Table Alvocidib 1 Within-assay precision (five measurements in the same run for each control) and between-assay precision (five measurements for each control, repeated for three consecutive days). a Control solution Within-assay Between-assay   Mean CV % Mean CV % 5 μg mL-1 5.27 3.51 5.87 4.56 25 μg mL-1 24.56 2.87 25.30 5.80 75 μg mL-1 75.92 3.15 74.17 6.58 a μg mL-1 B. cinerea antigen The correlations between

the lesion diameters of the fruit samples and the amount of B. cinerea antigen detected by the proposed method from infected fruit extracts samples obtained at 4, 7, and 10 d of incubation (25°C), respectively, are presented in Table 2. These results showed a correlation between the damage level and the amount of fungus present in the fruit samples. B. cinerea was detected even when the fruit rot was not visible yet but perhaps it had begun to germinate (about 4 days after inoculation

and incubation of the fruit samples). Tests in which the fruit samples were infected using different conidia suspensions of B. cinerea were also made: 1 × 104, 1 × 105, and 1 × 106 conidia mL-1, respectively. Absorbance measured after 4 d of incubation (25°C) did not show significant differences (data not shown), because pheromone the method only detect germ tubes in the precise moment they appear, and the quantity of germinated conidia does not always depend of the quantity of inoculated conidia. Table 2 Correlation between the lesion diameters of the fruit samples, the amount of B. cinerea antigen determinated by the ELISA developed and the DNA of B. cinerea quantified from infected fruit extracts samples obtained at 4, 7, and 10 days of incubation (25°C), respectively. Fruit samples Days of incubation bLesion diameters (mm/rot) c B. cinerea antigen (μg mL-1) c DNA- B. cinerea (μg mL-1) Apples (Red-delicious) a Control uninfected not detected not detected   4 not visible 10.53 ± 0.48 10.22 ± 0.53   7 20.11 ± 0.54 40.67 ± 0.37 38.75 ± 0.41   10 50.09 ± 4.49 69.08 ± 0.43 71.19 ± 0.