Method of study  In the first experiment, genes and pathways whose expression were regulated by CSF2 were identified by microarray analysis. Embryos were treated MK2206 with 10 ng/ml CSF2 or vehicle at Day 5 after insemination; morulae were selected for microarray analysis at Day 6. In a second experiment, antiapoptotic

effects of CSF2 were determined. Embryos were treated with CSF2 or vehicle at Day 5. On Day 6 (24 h after treatment), morulae were cultured for 15 h at either 42°C (a temperature that induces apoptosis) or 38.5°C (cow body temperature). Results  In the first experiment, a total of 214 genes were differentially regulated and 160 of these could be annotated (67 upregulated genes and 93 downregulated genes). Differentially expressed genes could be placed in 13 biological process ontologies in four functional groups (development and differentiation process, cell communication, apoptosis and cell adhesion). Antiapoptotic effects of CSF2 were confirmed in the second experiment because the magnitude of the increase in TUNEL positive cells caused by heat shock was reduced by CSF2. Conclusion  CSF2 blocks apoptosis in bovine embryos through actions associated with regulation of genes controlling apoptosis. “
“Pregnancy still represents one of the most fascinating paradoxical phenomena in science. Immediately after conception, the maternal immune system is challenged by the

presence of foreign paternal antigens in the semen. This triggers Small molecule library order mechanisms of recognition and tolerance that all together allow the embryo to implant and later the fetus to develop. Tolerance mechanisms to maintain pregnancy are of special Isotretinoin interest as they defy the classical immunology rules. Several cell types, soluble factors, and immune regulatory molecules have been proposed to contribute to fetal tolerance. Within these, regulatory T cells (Treg) are one of the most studied immune cell populations lately. They are reportedly involved in fetal acceptance.

Here, we summarize several aspects of Treg biology in normal and pathologic pregnancies focusing on Treg frequencies, subtypes, antigen specificity, and activity as well as on factors influencing Treg generation, recruitment, and function. This review also highlights the contribution of fetal Treg in tolerance induction and addresses the role of Treg in autoimmune diseases and infections during gestation. Finally, the potential of Treg as a predictive marker for the success of assisted reproductive techniques and for therapeutic interventions is discussed. “
“Retinoic acid or vitamin A is important for an extensive range of biological processes, including immunomodulatory functions, however, its role in gastrointestinal parasite infections is not yet clear. Despite this, parasite infected individuals are often supplemented with vitamin A, given the co-localised prevalence of parasitic infections and vitamin deficiencies.

In order to describe intragraft chimerism in detail, we apply a new method with laser capture microdissection of accurately selected areas of new bone formation in bone allotransplants. We aim to describe the lineage of cells in allotransplants as compared to isotransplants and study its progress over time. National Institutes of Health guidelines were followed and approval was obtained from our Institutional Animal Care and Use Committee. A VBAT model previously designed in our laboratory was used (Fig. 1A).[10] Eleven female Dark Agouti

rats (DA, RT1a) served as donors in the allotransplant groups. Ten female Piebald Viral Glaxo rats (PVG; RT1c) served as donors in the isotransplant groups. Male Piebald Virol Glaxo rats (PVG; RT1c) served as recipient selleckchem rats, providing a major histocompatibility mismatch for the DA donor rats. In the allotransplant group, 22 PVG rats DAPT solubility dmso were included with survival at two different time points: 4 weeks (group A, n = 11) and 18 weeks (group B, n = 11). Twenty PVG rats were allocated to the isotransplant groups with two survival periods: 4 weeks (group C, n = 10) and 18 weeks (group D, n = 10). Rats were allocated randomly to each

group. The female donor rat was anesthetized with ketamine (90 mg/kg IM) and xylazine (10 mg/kg IM) and the right femur was dissected with its nutrient vascular pedicle including the proximal common iliac artery and vein for later anastomosis. Next, the proximal and distal parts of the femur were resected, leaving a 20 mm femoral diaphyseal segment with its pedicle.

The intramedullary canal was reamed and the pedicle rinsed with heparinized saline. Next, a male PVG rat was anesthetized and the right femoral artery and vein were ligated. End to end anastomosis was performed. The contralateral saphenous arteriovenous bundle was dissected and implanted many into the full length of the donor bone intramedullary canal. The allotransplant was wrapped in a silicone sheath and placed in an abdominal subcutaneous pocket. Rats in all groups received daily intramuscular injections of FK-506 (1 mg/kg/day IM; Tacrolimus, Fujisawa Pharmaceutical Co., Osaka, Japan) during the first 2 weeks postoperatively. Animals were given calcein green and tetracycleine orange fluorescent labels 14 and 2 days, respectively, prior to sacrifice. These labels are absorbed in active bone remodeling areas, which allow clear microscopic identification of these areas (Fig. 1B). Rats were anesthetized with ketamine (90 mg/kg IM) and xylazine (10 mg/kg IM). To ensure that cortical bone was completely cleared from blood cells that could interfere with accurate cell heritage quantification, the vena cava and aorta were cannulated and the lower extremity irrigated with heparinized saline.

Therefore, if the general anesthesia is impossible or equipment, such as fluoroscopy and laparoscopy, were not available, this method may be an alternative choice for PD catheter placement. “
“Date written: November 2008 Final submission: August 2009 No recommendations possible based on Level I or II evidence (Suggestions are based primarily

on Level III and IV evidence) Distal protection devices should be considered for patients requiring renal artery angioplasty to prevent renal atheroembolism. Discussion between the nephrologist PD98059 chemical structure and interventional radiologist (and other relevant specialists) regarding the benefits and harms of distal protection in this context is strongly encouraged. A registry of the use of distal protection devices would contribute to our knowledge of the benefits and harms of distal protection. This would work best within a larger registry of renovascular intervention procedures. Atherosclerotic

renal artery stenosis (ARAS) is often associated with vascular disease in other vessels and is becoming increasingly common as the population ages and more people are investigated for reduced kidney function.1 The major clinical manifestations of ARAS are hypertension and reduced kidney function. Treatment options for ARAS include phosphatase inhibitor library medical management and revascularization. Although restoration of perfusion of the kidney should in theory help preserve kidney function, it remains unclear whether patients should undergo revascularization of the kidney or not. Revascularization is predominantly performed by percutaneous transluminal angioplasty of the vessel with insertion of a stent to reduce the rate of restenosis.2 In contrast to other vascular beds, such as the coronary or lower limb circulation, there are no symptoms to improve by restoring perfusion to the kidney. One risk of this procedure that is difficult to precisely quantify is the release of cholesterol fragments from atheromatous plaque, which travel distally into smaller renal vessels.3 The release of such

fragments has been demonstrated in an ex vivo model of renal artery angioplasty and PTK6 stent.4 The best estimate of this risk comes from the ASTRAL study in which the risk of renal or stent embolisation at 24 hours post-procedure without distal protection devices was 1.5% and the risk of non-renal embolisation at 24 hours was 1%.5 This complication can lead to permanent loss of kidney function and even end-stage kidney disease requiring dialysis, and can occur even weeks to months after the procedure. In order to prevent this complication, distal protection devices that are placed distal to the stenosis have been developed to trap embolic material that may be released during the angioplasty and stent insertion.

A series of dilutions were prepared from the remaining bacteria. Bacteria were cultured on Luria broth agar plates without antibiotic at 37° overnight. Colonies were counted the next day. The phagocytosis assay was performed as described previously.19,20 In brief, FITC-conjugated killed S. aureus (Invitrogen,

Darmstadt, Germany) was used for assay. The bacteria were opsonized before the assay. For this purpose, bacteria Selleckchem GW572016 were incubated with 5% serum (from the same donor from whom neutrophils were isolated) for 25 min at 37°. Non-infected neutrophils were pre-stimulated with PAR2-cAP 10−4 m, PAR2-cRP 10−4 m and/or IFN-γ 100 ng/ml for 2 hr at 37° and 5% CO2. Neutrophils and opsonized bacteria were co-incubated at 1 : 20 ratio (neutrophils : S. aureus). During co-incubation of bacteria and neutrophils, PAR2-cAP 10−4 m, PAR2-cRP 10−4 m and/or IFN-γ 100 ng/ml were applied in the concentrations indicated above. Co-incubation took place in assay medium on a shaker for 30 min at 37°. The phagocytosis assay was stopped Selleck Everolimus by the addition

of ice-cold PBS containing 0·5 mm EDTA (500 μl PBS to 1 ml of sample medium). Samples were then centrifuged at 169 g and neutrophil pellets were resuspended in ice-cold PBS containing 0·9% FCS and 2 mm EDTA. Trypan blue quench, which helps to discriminate adherent and ingested bacteria, was performed as described previously.21 The efficacy of phagocytosis was estimated using flow cytometry (FACS analysis). Measurements were performed for the next 15 min and all samples were kept on ice during measurements. At least 30 000 cells were analysed with the FACScalibur

and cell quest pro Software (Becton Dickinson, Heidelberg, Germany). Bacteria.  The S. aureus (SH1000) was kindly provided by Dr C. Eiff22 and S. aureus was grown for 18 hr in Mueller–Hinton bouillon at 37°. Bacterial Megestrol Acetate density was measured spectrophotometrically at 540 nm, after two PBS washings. The number of bacterial cells was calculated using a previously determined standard curve (based on the counts of colony-forming units). Finally, the concentration of bacteria in PBS was adjusted to 5 × 108 cells/ml. For the purpose of the quantitative analysis of phagocytosis by flow cytometry, S. aureus was incubated in PBS containing 0·1% FITC (Sigma Aldrich, Munich, Germany) for 1 hr at 37°. After being labelled, bacteria were washed three times before incubation with pre-treated leucocytes. Assay.  During pre-treatment, human monocytes or neutrophils (1 × 106 cells) were cultured in medium either without stimuli (‘control’) or containing the following stimuli: 100 ng/ml LPS; 1 × 10−4 m PAR2-cAP, 10 ng/ml or 100 ng/ml of IFN-γ. Monocytes or neutrophils were pre-treated for 2 hr at 37° and subsequently co-incubated with live FITC-labelled S. aureus at a ratio of 1 : 10 (cells : S. aureus) for 30 min at 37°.

Pain (NRS) 8 Intravenous ketamine; AED; NSAIDs; intermittent narcotics; antidepressants.   CRPS15 F/45 L5-S1 radiculopathy (disc)/20 years Dynamic, static mechano allodynia, all extremities; neurogenic oedema of legs; autonomic dysregulation; bilateral BPTI. Pain

(NRS) 8 AED; antianxiolytic; spasmolytics; antidepressants intravenous ketamine Depression CRPS16 F/41 Motor vehicle accident with BPTI on the left/14 years Spontaneous Maraviroc burning pain; mechano and thermal allodynia; autonomic dysregulation; neurogenic oedema; spread to ipsilateral cervical plexus and contralateral brachial plexus; weakness of hand muscles. Pain (NRS) 8 Intravenous ketamine; NSAIDs; AED; narcotics; antidepressants. Migraines; IBS CRPS17 F/31 Excision of neuroma of right foot/3 years Mechano and thermal allodynia; burning spontaneous pain; mirror spread; then to brachial plexus; autonomic dysregulation; neurogenic oedema; weakness. Pain (NRS) 9 AED; antidepressants; spasmolytics; memantine; narcotics; NSAIDs; intravenous ketamine. Depression; hypertension; hypercholesterolemia. CRPS18 F/52 Motor vehicle accident; BPTI/8·5 years Generalized

mechano allodynia; hyperalgesia; deep sensitization of muscle; weakness; difficulty initiating movement; positive Tinel signs of brachial plexus. Pain (NRS) 7 NSAIDs; AED; narcotics; antidepressants; intravenous ketamine; Staurosporine price intravenous lidocaine; ECT; spasmolytics. L4-L5-S1 radiculopathy; hypertension; hypercholesterolemia. CRPS19 F/48 Fell on outstretched arm; Thoracic outlet surgery/5 years Autonomic dysregulation; neurogenic oedema; hyperalgesia; positive brachial plexus Tinel signs; poor movement and weakness of the hand; mechano before and thermal allodynia. Pain (NRS) 8 NSAIDs;

AED; narcotics; spasmolytics; antidepressants; intravenous ketamine. GERD; migraine CRPS20 F/61 Motor vehicle accident. (flexion/extension neck injury)/5 years Generalized mechano and thermal allodynia; hyperalgesia; poor initiation of movement and weakness; autonomic dysregulation; oedema generalized from brachial plexus. Pain (NRS) 7 NSAIDs; AED; antidepressants; spasmolytics; narcotics; intravenous ketamine. Depression; hypercholesterolemia; Breast Cancer 1998. CRPS21 M/58 L4-L5 left radiculopathy; fell from 20 feet/5 years Sharp stabbing pain; mechano allodynia Left>Right leg; myoclonic jerks; atrophy; weakness; autonomic dysregulation. Pain (NRS) 8 AED; NSAIDs; narcotics; mexiletine; intravenous lidocaine. Hypertension; GERD. CRPS22 F/34 Fibroadenoma invading the right brachial plexus; two surgical biopsies/7 years Autonomic dysregulation; neurogenic oedema of right arm; weakness of distal right arm muscles; mechano and thermal allodynia; deep sensitization. Pain (NRS) 6·5 NSAIDs; AED; narcotics; antidepressants. Depression/panic attacks.

As illustrated in Supporting Information Fig. 3A, in wild-type embryonic fibroblasts, that express very low level of Abl (data not shown), podosome rosettes contained the product of the Abl-related gene (Arg), the other member of the Abl kinase family. Notably, fibroblasts with the triple deficiency of Src, Yes, and Fyn (SYF fibroblasts) were unable to form podosomal rosettes (compare Supporting Information

Fig. 3A and C with B and D) thus implicating a SFK/Abl kinase as a signaling module indispensable for podosome formation in different selleck kinase inhibitor cell types. Having established that Abl is a macrophage podosome component, we addressed whether this kinase is indispensable for podosome formation. As shown in Fig. 2A and C (central panel), siRNA-induced silencing of Abl expression in BMDMs resulted in disassembly of podosome rosettes. This effect was dependent on a selective silencing of Abl, and not the Abl-related kinase Arg, expression because the siRNA we used did not decrease expression

of Arg Fig. 2B. Notably, reduced expression of Abl by siRNA also resulted in a marked reduction in phosphorylation GPCR Compound Library order of the Abl substrate CrkL both constitutively and upon plating of BMDMs on fibronectin Fig. 2B. Similar results were obtained inhibiting Abl kinase activity with imatinib mesylate (STI) Fig. 2C, right panel). In fact, whereas BMDMs formed several podosome rosettes when plated on fibronectin (Fig. 2C, left panel, yellow arrows) even a short (30 min) treatment with STI resulted in rosette disassembly Fig. 2 C, right panel. In order to establish a relationship between Abl-dependent podosome formation and myeloid cell invasive ability, we plated BMDMs on gelatin-FITC-coated coverslips for 24 h and examined gelatin degradation (Fig. 2D). siRNA-induced silencing of Abl expression resulted in an almost total suppression of matrix degradation (Fig. 2D, right panel). That Abl is required for matrix degradation by myeloid leukocytes was also demonstrated by the finding that the capability of human monocyte-derived macrophages to degrade gelatin was markedly anti-EGFR antibody inhibitor inhibited by imatinib mesylate

(Fig. 2E). Considering that macrophage migration in 3-dimension (3D) and trans-endothelial migration of leukocytes from blood to the interstitium [[3, 17]] require podosome formation we addressed whether silencing of Abl resulted in a reduced migration through an extracellular matrix or an endothelial cell monolayer. As shown in Fig. 3A and B silencing of Abl resulted in a significant inhibition of both type of migratory forms. Although there is not a simple correlation between podosome formation and cell migration, at least in two dimensions [[2]], the efficacy of siRNA in suppressing Abl expression in BMDMs allowed us to address whether the indispensability of Abl in regulating BMDM migration demonstrated with inhibitory drugs [[12]] could be strengthen by studies with Abl-deficient cells.

For example, it has been widely shown that the major lineages of T. cruzi exhibit significant differences in pathogenic potential. Trypanosoma cruzi I, generally less pathogenic for humans, has a lower acute infectious profile and progression, a more extensive chronic profile, and invades and causes pathology in different organs. Comparison of at least one T. cruzi I isolate (e.g., Silvio ×10) with the other isolates will provide an opportunity to discover the genetic basis of these phenomena. Another outstanding question

relates to the genetic basis for a variety of phenotypes (cell cycle, host range, vector selection, pathogenic and clinical manifestations, etc.) of the major groups of pathogenic Dabrafenib in vivo trypanosomatids. Again, considering T. cruzi as an example, isolates of the six lineages of T. cruzi are quite divergent in many respects. Although superficially similar, their preferred hosts and vectors, method of invasion, effects on the invaded cells, levels of parasitemia, mechanisms of pathogenesis and clinical outcomes are quite different. Whereas it is quite well documented that the

differences among T. cruzi isolates are genetically programmed, it is not yet established that genes or gene networks confer these different phenotypes. The genome of www.selleckchem.com/products/Gefitinib.html trypanosomes is transcribed into long polycistronic primary transcripts (mostly by RNA polymerase II) and pre-mRNAs are processed into mature individual mRNAs through coupled trans-splicing and polyadenylation events (8). It has therefore been widely considered that trypanosomes heavily rely on post-transcriptional regulation and RNA turn-over rather than transcription initiation to regulate gene expression (28). Nonetheless, several genome-wide gene expression profiling studies have been carried out to interrogate the

differences in the distinct developmental life cycle stages in trypanosomatids. Many of the studies have revealed considerable numbers of regulated genes during trypanosome development (29–35), although some analyses noted limited and inflexible transcriptome responses across the life cycle stages (36–38). Results from multiple microarray studies were recently integrated bioinformatically selleck inhibitor and co-expression clusters were used to predict putative gene functions and potential regulatory networks (38). In addition, DNA microarrays coupled with chromatin immunoprecipitation (ChIP-chip) have allowed the identification of the origins of polycistronic transcription initiation through histone acetylation profiling (39). The application of NGS technologies to transcriptome profiling (40,41) has prompted the use of alternative and more powerful approaches for analysing gene expression in trypanosomatids.

Memory T-cell differentiation has been proposed to follow either a linear or a divergent pathway. The major distinction between the two models relates to whether memory T cells arise from

the effector activation state in a linear fashion, or bypass the effector state altogether by diverging toward memory cell differentiation [35]. Our study presented here does not distinguish between the linear and divergent differentiation models [36-38]. However, it would be intriguing XL765 to speculate that Dlg1 may regulate asymmetric cell division [39] in a divergent model of memory T-cell differentiation [38]. Indeed more recently, it was shown that asymmetric division occurs during Ag rechallenge [40]. It is also not clear whether and how Dlg1 may regulate intracellular signaling in TCR-dependent or -independent mechanisms leading to memory T-cell differentiation. A selleck chemicals llc recent study suggested that TCR signaling in Ag-experienced T cells depends on Dlg1 as compared with Ag-naïve T cells. However, the role of this mechanism was not tested in the context of T-cell

memory generation [12]. In addition, it was observed that Dlg1 interacts with potassium channels and presumably regulates their function by retaining channel subunits at the plasma membrane [19]. Accordingly, the loss of potassium channel function results in reversion of Tem into Tcm [41], and may suppress the function of Tem [42]. Thus, Dlg1 could be involved in regulation of functional memory T-cell diversity by regulation of

potassium channel activity. Indeed Kv.1.3. KO mice were shown to have increased frequencies of Tcm and be partially resistant to EAE development and progression, which was explained by mechanisms related to either impaired effector memory T-cell functions and/or acquisition of Treg-cell phenotype [43]. Importantly, more recently it was observed that loss of Dlg1 in human L-NAME HCl Treg cells results in impaired function of this subset [44]. The latter is consistent with our observation of increased IL-2 cytokine production observed in Dlg1 KO mice after immunization. While further studies into the mechanism of Dlg1 in regulation of memory T-cell differentiation will be needed to address all unresolved issues, we show here for the first time that Dlg1 protein contributes to determination of functional memory T-cell diversity. Generation of the T cell-specific Dlg1 conditional KO mouse has been previously described [17]. Lck-Cre, Vav1-Cre, OT1, OT2, and HY mice were previously described [21-25]. All animal procedures were performed in accordance with institutional guidelines and approved by the Animal Studies Committee at Washington University School of Medicine. To determine Cre expression, the following primer set was used: 5′ ACCAGAGACGGAAATCCATCG 3′ and 5′ CCACGACCAAGTGACAGCAATG 3′. To analyze deletion of the floxed allele in lymphoid cells, the following set of primers was used: 5′ ATGCTGACTGGAAGGACTGC 3′ and 5′ TCAGAGACCACAAGAGGC 3′.

Because these intranuclear structures do not have a membrane, the components of nuclear bodies and nuclear structures can rapidly interact. Many components of nuclear bodies change quickly, and an increased retention time of each component at a place represents foci.[27, 51] Therefore, the interaction should be regulated temporally and rapid dissociation depends

on the circumstance. Finally, we examine the possibility that TDP-43 directly contributes to the formation of Gems. In TDP-43-depleted cells, DAPT price a substantial number of Gems were still observed, whereas TDP-43 was not detected in the nucleus or Gems.[34] In addition, not all Gems include TDP-43 in cultured cells and normal spinal motor neurons.[34] Moreover, the size of each Gem was similar between control and ALS cells.[34] These results clearly indicate that TDP-43 is not a necessary component for all types of Gems. Thus, we propose two possibilities regarding the contribution of TDP-43 in the formation of Gems: (i) TDP-43 contributes to the formation of Gems only at a specific stage during their maturation (Fig. 2a); or (ii)

TDP-43 is associated with only a subtype of Gems, but not all Gems (Fig. 2b). Interestingly, the overexpression of TDP-43 also decreased the number of Gems in the cultured cells,[34] indicating that the proper amount of each component is important for maintaining the number of Gems. One outcome of a decrease in the number of Gems can be speculated based on the molecular mechanism underlying spinal muscular Inhibitor Library order atrophy. Gems are the sites of assembly and maturation of snRNP.[29, 31, 52] In the assembly of snRNP, SMN first forms a dimer and directly binds to Gemin 2, 3 and 8 and indirectly binds to Gemin 4, 5, 6 and 7 and unrip.[53] This SMN complex then binds to the Sm complex and U snRNA and transports them into the nucleus.[47] At the Gems, additional proteins are assembled to snRNPs and U snRNAs are modified, consequently forming a spliceosome, which functions for pre-mRNA splicing. In addition, Gems accumulate at most U snRNA genes.[30] These findings suggest that the Gems may regulate the quality

as well as the quantity of the U Mannose-binding protein-associated serine protease snRNA. Therefore, researchers have speculated that the depletion of SMN or Gems may result in decreasing amounts of SMN complex, snRNPs and U snRNAs. Indeed, Gemin 2, 3 and 8 are decreased in SMN-depleted cells and tissues.[54, 55] In addition, the assembly of snRNP is also disrupted in these cells and tissues. Furthermore, a subset of U snRNA is decreased in the affected tissues in spinal muscular atrophy.[47, 54] The U snRNAs are involved in the splicing machinery, the spliceosome, and are categorized into major and minor classes depending on the consensus sequences of the donor and acceptor splice sites of the introns.[56] Most of the splicing is regulated by major spliceosomes, whereas less than 1% is regulated by minor spliceosomes.

However, there is marked regional variation in the uptake of home haemodialysis (HD) and peritoneal dialysis (PD) suggesting further scope for the expansion of these modalities. Methods:  Between 1 April and 5 August 2009, Australian nephrologists were invited to complete an online survey. Seventy-six questions were INK 128 asked covering characteristics of the dialysis units, responders’ experience, adequacy of facilities and support structures, attitudes to the use of home HD and PD and issues impeding the increased uptake of home dialysis. Results:  Completed surveys were received and analysed from 71 respondents; 27 from Heads of Units (35% response rate) and 44 (16%) from other nephrologists. There was strong agreement

that HD with long hours was advantageous

and that this was most easily accomplished in the home. PD was not considered to be an inferior therapy. A ‘PD first’ policy existed in 34% of Renal Units. The most commonly reported impediments to expanding home dialysis services were financial disadvantage for home HD patients, and lack of physical infrastructure for training, support and education. Areas of concern for expanding home dialysis programmes included psychiatry support, access to respite care and home visits, and lack of support from medical administration and government. The majority of nephrologists would recommend home dialysis to more patients if these impediments could be overcome. Conclusion:  This survey identified support from nephrologists for the expansion of home dialysis in Australia and highlighted important barriers to improving access to these therapies. “
“Aim:  selleckchem Autophagy is a cellular process of degradation of damaged cytoplasmic components and regulates cell death or proliferation. Unilateral

ureteral obstruction (UUO) is a model of progressive renal fibrosis in the obstructed kidney. And UUO is followed by compensatory cellular proliferation in the contralateral kidney. We investigate the role of autophagy 4��8C in the obstructed kidney and contralateral kidney after UUO. Methods:  To obtain the evidence and the patterns of autophagy during UUO, the rats were sacrificed 3, 7 and 14 days after UUO. To examine the efficacy of the autophagy inhibitors, 3-methyladenine (3-MA), the rats were treated daily with intraperitoneal injection of 3-MA (30 mg/kg per day) for 7 days. Results:  After UUO, autophagy was induced in the obstructed kidney in a time-dependent manner. Inhibition of autophagy by 3-MA enhanced tubular cell apoptosis and tubulointerstitial fibrosis in the obstructed kidney after UUO. In the contralateral kidney, autophagy was also induced and prolonged during UUO. Inhibition of autophagy by 3-MA increased the protein expression of proliferating cell nuclear antigen significantly in the contralateral kidney after UUO. The Akt-mammalian target of rapamycin (mTOR) signalling pathway was involved in the induction of autophagy after UUO in both kidneys.